Next-Generation Sequencing Validation Challenge Samples

NIBSC has an ongoing programme to develop WHO International Standards for cancer genomics which includes the capture of not only clinically-relevant variants, but also wider genome sequencing information which may be useful for the validation of next-generation sequencing pipelines.  

Additionally, some of our disease-specific reference materials are well-suited to addressing common difficulties in NGS.

Under-representation of High-GC exons in capture targeted sequencing

Control material available for:

MSH2 – Exon 1 deletion (GC content 65.7%)

Also MSH2 – Exons 1-2 deletion; MSH2 – Exons 1-6 deletion

See: 11/218:  MLH1/MSH2 Exon Copy Number Reference Panel 

Sequencing accuracy in homopolymer regions

Control material available for:

MSH2 - Intron 5 c.942+3A>T at Exon 5 /Intron 5 junction. Splice site mutation next to start of a 27bp intronic poly‐A tract

Exon 5 --ATATTGCAGCAGTCAGAGCCCTTAACCTTTTTCAGGTAAAAAAAAAAAAAAAAAAAAAAA

AAAAGGGTTAAAAATGTTGAATGGTTAAAAAATGTTTTCATTGACATATACTGAAGAAGC—Intron 5

See: 11/218:  MLH1/MSH2 Exon Copy Number Reference Panel  

Copy-number-neutral structural mutation

Control material available for:

Intra-chromosomal inversion (Chr. X)

Samples within the panel contain this inversion on the X-chromosome in hemizygous and heterozygous form.

See: 08/160: Factor VIII intron 22 Inversion (Haemophilia, WHO)

Copy-number-neutral loss of heterozygosity

Putative control material available for:

Probable Chr.15 uniparental isodisomy in 07/234 sample within panel 09/140: Prader Willi and Angelman Syndromes (WHO) – isodisomic mutation has been inferred but awaits confirmation.